SGN Marker T1460

SGN-M2019
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAU39TH
Arabidopsis best BAC match: AC016827.5
Arabidopsis position: 3.0118000
Arabidopsis identities: 0.714
Best GenBank protein hit: AAF27002.1
Evalue: 2.1e-84
Identities: 0.724
Description: putative DEAD/DEAH box helicase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39629)
Chromosome
11
Position
47.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1460 was used as an overgo probe on plate 10 [well G3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTGGTGTTCCATTCCGGTCTATG
B sequence
AGCCACCAGTAACAACCATAGACC
AB sequence
TCTGGTGTTCCATTCCGGTCTATGGTTGTT
Marker sequence
GCTCGTGTTGTAATATTGGCACCAACAACTGAATTGGCTTCTCAGGTTTT
AAATACTTGCCGTTCATTTTCAAAATCTGGTGTTCCATTCCGGTCTATGG
TTGTTACTGGTGGCTTTCGCCAGAAAACTCAACTGGAGAACCTAAGACAG
GAGTTGGACGTTCTTATTGCAACTCCTGGTCGGTTTATGTTTCTTATCAA
AGAGGGTTACTTGCAGTTAACTAACCTCAAGTGTGCTGTGTTGGATGAGG
TTGACATCCTCTTTAATGATGAGGATTTTGAGACTGCATTTCAATGCTTG
ATTAATTCATCACCTATCACCACACAATATCTATTTGTGACTGCTACTTT
GCCCATGGACATATACAACAAGTTGGTAGAAAGTTTTCCTGATTGCGAAC
TAGTGACTGGTCCTGGTATGCACCGTACAAGCCCTGGCTTGGAAGAGGTC
CTTGTAAATTGCAGTGGAGATGAAACAGCTGAAAAAAGTCCGGACACAGC
TTTTCTCAACAAAAAGAATGCCCTACTTCAGCTGGTGGAACGTAGCCCAG
TTCCAAAAACAATCGTCTTCTGTAACAAGATTGATAGCTGCAGAAAAGTT
GAGAACGCATTGAAGCGCTTTGATA
Genomic location of T1460  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2019 marker 2019
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)