SGN Marker solcap_snp_sl_21955

SGN-M20192

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64104)
Chromosome
2
Position
23.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56523)
Chromosome
2
Position
31.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGACCCTTGGTATTAGGCACTTCTCTGAAATCTTTAGGCCTACCTTCAT
  
3' flanking region
GTGTTCGTGTCCTCCCTTGCTGCTTATCACGAGTAGATATCAGTGTGTAG
SNP nucleotide
TC
SNPdb format
GAGACCCTTGGTATTAGGCACTTCTCTGAAATCTTTAGGCCTACCTTCAT[T/C]
GTGTTCGTGTCCTCCCTTGCTGCTTATCACGAGTAGATATCAGTGTGTAG
  
Genomic location of solcap_snp_sl_21955  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20192 marker 20192
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)