SGN Marker solcap_snp_sl_22071

SGN-M20200

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67718)
Chromosome
7
Position
7.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64109)
Chromosome
7
Position
11.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56531)
Chromosome
7
Position
3.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATAGACGATTTAAGTTTGTAGCTAGCGCTATATCCTTACATGCAACACTT
  
3' flanking region
TAGATATATCTCACACGCTATGTCATGTGAGTAAAAAGTGTCTAATAGAT
SNP nucleotide
TC
SNPdb format
ATAGACGATTTAAGTTTGTAGCTAGCGCTATATCCTTACATGCAACACTT[T/C]
TAGATATATCTCACACGCTATGTCATGTGAGTAAAAAGTGTCTAATAGAT
  
Genomic location of solcap_snp_sl_22071  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20200 marker 20200
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)