SGN Marker solcap_snp_sl_2218

SGN-M20208

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71362)
Chromosome
1
Position
83.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67720)
Chromosome
1
Position
69.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56539)
Chromosome
1
Position
78.31 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAGGCAGGTTGTGCTTAGGAGAATATTGTGGTCTCGGGGAAACAAACGA
  
3' flanking region
CCACCAGCATTATTTGACCTATGTTCTGCTGGGGTTGCATCTGCACCCTT
SNP nucleotide
AG
SNPdb format
GGAGGCAGGTTGTGCTTAGGAGAATATTGTGGTCTCGGGGAAACAAACGA[A/G]
CCACCAGCATTATTTGACCTATGTTCTGCTGGGGTTGCATCTGCACCCTT
  
Genomic location of solcap_snp_sl_2218  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20208 marker 20208
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)