SGN Marker solcap_snp_sl_224

SGN-M20225

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71367)
Chromosome
5
Position
78.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67726)
Chromosome
5
Position
80.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64115)
Chromosome
5
Position
130.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56556)
Chromosome
5
Position
63.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCGCATTAAATTCTCAAAAACTCCTCTCTCTCTCACACACAAAAATGGCC
  
3' flanking region
TAAAATTCAACCGCAATCTCGCCGGAACTCTCTTCGCCGCCGTGGTAGTC
SNP nucleotide
AC
SNPdb format
CCGCATTAAATTCTCAAAAACTCCTCTCTCTCTCACACACAAAAATGGCC[A/C]
TAAAATTCAACCGCAATCTCGCCGGAACTCTCTTCGCCGCCGTGGTAGTC
  
Genomic location of solcap_snp_sl_224  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20225 marker 20225
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)