SGN Marker solcap_snp_sl_22584

SGN-M20244

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71376)
Chromosome
5
Position
54.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67734)
Chromosome
5
Position
61.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64123)
Chromosome
5
Position
71.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56575)
Chromosome
5
Position
60.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTTTCCATTTGAGACATTGCGCTAATGACTGGTGGTTATGGTGACACTT
  
3' flanking region
CATTTTTGCTCTTAATTTTTGTACTCTTCTCTGGCCTCTTAGGAATATAC
SNP nucleotide
AG
SNPdb format
TGTTTCCATTTGAGACATTGCGCTAATGACTGGTGGTTATGGTGACACTT[A/G]
CATTTTTGCTCTTAATTTTTGTACTCTTCTCTGGCCTCTTAGGAATATAC
  
Genomic location of solcap_snp_sl_22584  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20244 marker 20244
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)