SGN Marker solcap_snp_sl_22623

SGN-M20274

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71391)
Chromosome
5
Position
58.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67744)
Chromosome
5
Position
63.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64133)
Chromosome
5
Position
89.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56605)
Chromosome
5
Position
61.03 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGGAAGATGGAGAGGGATTGACCCAATATTATTTTACCACGAGGAGACA
  
3' flanking region
CAGTGGGTCAGATAAAGGCCTTCTATGGCATTAAGGAATCCTTTCCATTC
SNP nucleotide
AG
SNPdb format
GAGGAAGATGGAGAGGGATTGACCCAATATTATTTTACCACGAGGAGACA[A/G]
CAGTGGGTCAGATAAAGGCCTTCTATGGCATTAAGGAATCCTTTCCATTC
  
Genomic location of solcap_snp_sl_22623  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20274 marker 20274
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)