SGN Marker T1475

SGN-M2028
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.05
Tomato EST read: TPTAV33TH
Arabidopsis best BAC match: AC009325.6
Arabidopsis position: 3.0030000
Arabidopsis identities: 0.919
Best GenBank protein hit: AAC50041.1
Evalue: 5.4e-37
Identities: 0.764
Description: poly(A) polymerase [Pisum sativum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39632)
Chromosome
2
Position
90.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1475 was used as an overgo probe on plate 13 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTCTCAAGATTGCTGGTGTCAAGG
B sequence
TCAACAGAGTCAAGCGCCTTGACA
AB sequence
GTCTCAAGATTGCTGGTGTCAAGGCGCTTG
Marker sequence
GCCCAAATGTCCTCTAGAATTGCTTGACTGTGTAAACAAACTAGTTGTAA
ATTCATCAATGGCAGCATCTGTTTCCTGCCACTATTTTTCTTCCCCATTA
ACAACTTCCACCAAATCCATCAAGCCTAAGCTCAATTACAGCCATTTCGC
ACCTGCTCTTAGTAAAGGATCGATCCGCCATTTTGTTCCACTATGTTCTT
CACAAAGCTCGCTTCCTTCTGAATCTGAATGCCAAGACAAAGAGAAAGAT
TGGTTTTTGTCATTGAAGAAATGTGCAGCTGCAGTTGCATTGTCAGTTAG
TTTGATTAGTGGACTACCTGGATCGCAATGGTTGGGTCCTGCTCATGCGA
GCACCCCAGCATTGCCAGATGTCTCTGTATTGATCTCAGGGCCACCGATT
AAGGATCCAGGGGCGTTATTGAGGTATGCATTGCCTATAGACAACAAGGC
GATAAGAGAAGTCCAAAAACCCCTTGAAGATATTACTGATAGTCTCAAGA
TTGCTGGTGTCAAGGCGCTTGACTCTGTTGAAAGAAATACATGACAAGCA
TCTCGAGCTCTTAAGGAAGGGAGGACCTTGATTATTTCAGGAGTAGCTAA
GTCAAAGACTGACCAC
Genomic location of T1475  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2028 marker 2028
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)