SGN Marker solcap_snp_sl_22770

SGN-M20290

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71396)
Chromosome
7
Position
34.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67750)
Chromosome
7
Position
30.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56621)
Chromosome
7
Position
53.09 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGGACTTGAGAAAAGTGGAACCAAGGATGGGGACAATGAGGATGGACT
  
3' flanking region
ACGAACAGAGACAAGGTTCTTGATCAAAATACTAGCCGTATGGTTGAAAA
SNP nucleotide
AT
SNPdb format
GATGGACTTGAGAAAAGTGGAACCAAGGATGGGGACAATGAGGATGGACT[A/T]
ACGAACAGAGACAAGGTTCTTGATCAAAATACTAGCCGTATGGTTGAAAA
  
Genomic location of solcap_snp_sl_22770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20290 marker 20290
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)