SGN Marker T1478

SGN-M2030
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.07
Tomato EST read: TPTAV53TH
Arabidopsis best BAC match: AC003981.2
Arabidopsis position: 1.0220000
Arabidopsis identities: 0.962
Best GenBank protein hit: AAF99765.1
Evalue: 9e-105
Identities: 0.861
Description: hypothetical protein [Arabidopsis thaliana]
Comment: 2.00E-45 match with emb|CAB55340.1| (AJ242865) GPI:protein transamidase [Leishmania mexicana]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39633)
Chromosome
10
Position
18.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1478 was used as an overgo probe on plate 15 [well H2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGGTTGACACTTGCCAAGCTGCT
B sequence
GCTGCGAGAAAAGAGTAGCAGCTT
AB sequence
ATGGTTGACACTTGCCAAGCTGCTACTCTT
Marker sequence
GGTTCATCTGCGACCACTACGATGCATACTAACAATTGGGCTGTTTTGGT
CTGCACTTCTCGTTTCTGGTTTAACTACAGACACATGGCTAACACTTTGT
CTTTATACAGAACCGTAAAACGATTAGGCATACCTGATGAAAGAATTATT
CTGATGTTGGCTGATGATATGGCTTGCAATACTCGAAATAAATACCCTGC
ACAGGTCTTCAACAATGAAAATCACAGGCTAAACCTTTATGGAGATAACG
TTGAGGTTGATTATCGAGGTTATGAAGTAACAGTTGAAAATTTTCTGAGG
GTGCTGACTGGACGTCATGAAACAGCTGTCCCAAGATCAAAACGTCTTCT
TAGTGATGAAGGAAGCCACATACTTCTGTACATGACAGGGCATGGCGGAG
ACGAGTTTTTAAAATTTCAGGATTCAGAAGAACTTCAAAGTCATGATTTA
GCTGATGCAGTGAAACAAATGAAAGAAAAGCGTAGATTCAAGGAGCTGCT
AATAATGGTTGACACTTGCCAAGCTGCTACTCTTTTCTCGCAGCTTCAAT
CACCTGGCGTATTGACAATTGGGAGTAGCATGAAAGGAGAAAATTCATAC
TCGCACCACTTGGATGCTGATGTTGGTGTCTCAGTTATTGATCGATTCAC
AT
Genomic location of T1478  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2030 marker 2030
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)