SGN Marker T1481

SGN-M2033
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAV67TH
Arabidopsis best BAC match: AL096692.1
Arabidopsis position: 4.1500000
Arabidopsis identities: 0.647
Best GenBank protein hit: CAB79679.1
Evalue: 1.2e-54
Identities: 0.664
Description: gamma-glutamyltransferase-like protein [Arabidopsis
Comment: no experimental evidence
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39635)
Chromosome
12
Position
32.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1481 was used as an overgo probe on plate 1 [well G6]

Plausible BAC Matches:   P325K22,   P225A13,   P298M14,   P059N16,   P075C18,   P106E17,   P257N01,   P328J18,   P240D15,   P326L07,   P098P04,   P317D23,   P291A08,   P336O02

 Overgo Sequences

A sequence
AGCAGTTGTTGCTGCTGATGATGG
B sequence
GATTTTCGAGCACCGACCATCATC
AB sequence
AGCAGTTGTTGCTGCTGATGATGGTCGGTG
Marker sequence
GTCTACTTCTCCTCTTTGTTCTAATACAAAGAAAAAATGGAGTTTTTTTC
TTTGCTTTTTATTTGCATTCATTGCCATAGCATTTGTTGGGCTTACACAT
CATGGAGACATTGGTGTATGGCTAATTGGAGATGTAAATAGTAGTAGATA
TAATGGAAAACTAGAGCACAATGCTGATGTTGTTGAATCAGAGGAAGCAG
TTGTTGCTGCTGATGATGGTCGGTGCTCGAAAATCGGTATTTCTATGCTT
AAAATTGGTGGACATGCAGTTGATGCTGCAGTTGCCACAGCATTGTGCCT
TGGAGTAGTGAATCCAATGGCTAGTGGAATTGGCGGTGGCGGTTTTATGG
TTGTTAGATCTTCATCTACATCAGAAGTCTTAGCTATTGACATGAGGGAA
ACTGCTCCTTTAGCTGCTTCACAGAACATGTATGATAATAATGGGGACTC
CAAGTTAAATGGAGCGTTGTCGATGGGAGTTCCCGGGGAGCTAGCTGGTC
TTCACGCAGCTTGGTCGAATTATGGTAGGTTGCCCTGGAAGACACTATTT
CAACCAGCCATTAAACTTGCCAGGGAGGGATTCGTGGTTGCTCCATATCT
CGGAAACTCTATAGCTAAAAAAGCAAAATTACTACTTAAAGATCCCGGCT
TGCGACAAGTATTTGCACCTGAGGGAAA
Genomic location of T1481  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2033 marker 2033
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)