SGN Marker T1482

SGN-M2034
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.05
Tomato EST read: TPTAV74TH
Arabidopsis best BAC match: AC005970.2
Arabidopsis position: 2.0320000
Arabidopsis identities: 1.000
Best GenBank protein hit: CAA05879.1
Evalue: 6.2e-69
Identities: 0.797
Description: enoyl-ACP reductase [Petunia x hybrida]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49442)
Chromosome
10
Position
59.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47376)
Chromosome
10
Position
44.38 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39636)
Chromosome
10
Position
50.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1482 was used as an overgo probe on plate 6 [well A3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCGTGGGAAATTTGACCAATCACG
B sequence
ACCATCAGGCAACACTCGTGATTG
AB sequence
CCGTGGGAAATTTGACCAATCACGAGTGTT
Marker sequence
GCTCTCACTCACTACATTTTCAAAGCTCCTCAACTTCGATTTCATCGAAA
GAGACCTATATTAATTCTACTTTGAGAAATCTAAATCAGTTTATTTTCTT
CTTTAAGCATTGTTTCTTCGTTTTCATCGACTTGAGATTCTTCTTTGTCG
GAAATGGCTGCAAACACAACTCCTGGCTTGCAAATACAAGCAACCAAACA
ATGCATTCCTGCATCGCAGAATGTTTCAAAAATGAGCACTATGAGTTTCA
ATTTTGGAAGTAAAAGAAAATCTTTTACTGATTTTAGAAGTTCATCACAT
ATCTCGCTCACGAAGCCAATCCATAGCTTCAAATTGGCTCCTATAAAATT
TGAAAGGATGGTTACAAAAGCAATGTCTGGAGCTAGTGAACAAGTGCCAG
TTTCAGGGTTGCCTATTGATCTGAGAGGTAAGAGGGCATTTATTGCTGGC
ATAGCAGATGACAATGGGTATGGATGGGCAATAGCAAAGTCTCTTGCTGC
TGCAGGGGCTGAAATTCTTGTTGGTACATGGGTGCCTGCGCTCAACATTT
TCGAGACCAGTCTGCGCCGTGGGAAATTTGACCAATCACGAGTGTTGCCT
GATGGTTCATTGATGGAAATTGCAAAAGTCTACCCATTGGATGCCGTCTT
TGACAGTCC
Genomic location of T1482  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2034 marker 2034
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)