SGN Marker solcap_snp_sl_22914

SGN-M20347

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67769)
Chromosome
6
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64157)
Chromosome
6
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56678)
Chromosome
6
Position
0.93 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAGCATGGTCGTTGCACCAGCAGAACTTAATTTTTTCATAAAGGGCAAA
  
3' flanking region
AAGGATCTTTACTTCCACTGCAAGCAGGCTCTGGATGACAGAAAGTGCAA
SNP nucleotide
CG
SNPdb format
TGAGCATGGTCGTTGCACCAGCAGAACTTAATTTTTTCATAAAGGGCAAA[C/G]
AAGGATCTTTACTTCCACTGCAAGCAGGCTCTGGATGACAGAAAGTGCAA
  
Genomic location of solcap_snp_sl_22914  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20347 marker 20347
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)