Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_22930

SGN-M20359

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56690)
Chromosome
6
Position
0.88 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGCTTTTGATGGTTTCCTCGTGTTTGCAAAACAGGAAAAAATTCACAT
  
3' flanking region
GATAGAAGGCTATTTAAACTATTAGTCAAATCATTTCTTGATATCCATAG
SNP nucleotide
TG
SNPdb format
ATTGCTTTTGATGGTTTCCTCGTGTTTGCAAAACAGGAAAAAATTCACAT[T/G]
GATAGAAGGCTATTTAAACTATTAGTCAAATCATTTCTTGATATCCATAG
  
Genomic location of solcap_snp_sl_22930  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20359 marker 20359
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)