SGN Marker T1485

SGN-M2037
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAV94TH
Arabidopsis best BAC match: AC005388.1
Arabidopsis position: 1.0990000
Arabidopsis identities: 0.779
Best GenBank protein hit: AAC64889.1
Evalue: 8.0e-44
Identities: 0.596
Description: conceptual translation.[Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39638)
Chromosome
1
Position
103.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1485 was used as an overgo probe on plate 1 [well F8]

Plausible BAC Matches:   P242O01,   P057C07

 Non-Plausible BAC matches

P159C14,   P270A21,   P018A19

 Overgo Sequences

A sequence
CTTCCCATGGAAACCATTCTCTCC
B sequence
GAGGAGAAAAAGGAGGGGAGAGAA
AB sequence
CTTCCCATGGAAACCATTCTCTCCCCTCCT
Marker sequence
CCTGTATTTTCTCACAAATTTTGATCTGTTACTGTTTCTCTTCCCATGGA
AACCATTCTCTCCCCTCCTTTTTCTCCTCTCTTCAACCCCAAAACTTCCC
TTTCAAAGCCTTTTCTTTCCCTTACTCACTTACCCAGATCAACTAAGCCA
ATTTGCTGTAGCCTCAGAAAACAGCATTCCCAGATTGAAAAACAATCTTT
TTCAGTACCCAAAAGTTGGGTTTCTCATGTCCAGCAAGGATTAGCTGCTC
TAGCTATTTCTTTAGCCCTTAATTTTTGTCCAGTTGTGTCTTCTGAGTCT
GCATTGGCATCTGAATTTGATGTGTTAAATGAAGGGCCACCAAAGGACTC
ATATGTGGTTGATGATGCTGGTGTGCTTAGCAGGGTGACAAAGTCTGATT
TGAAGGCATTGTTGTCAGATGTGGAGAAGAGAAAAGGCTTCCACATTAAT
TTCATCACTGTCCGCAAGCTCACTAGCAAAGCTGATGCTTTTGAGTATGC
TGATCAAGTTTTGGAGAAGTGGTATCCTAGTGTTGAACAAGGAAACGATA
A
Genomic location of T1485  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2037 marker 2037
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)