Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_22977

SGN-M20390

Synonyms  
CL016793-0131
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56721)
Chromosome
6
Position
0.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAATCGGAGCATAATTTGGGGGTTTTGAGTTATTGGATCTAACCGGGTTT
  
3' flanking region
TTGGGTTGAGTTTTGACTGATCTCCGGCGACTGCAGATGTCTTCGTACTG
SNP nucleotide
AG
SNPdb format
AAATCGGAGCATAATTTGGGGGTTTTGAGTTATTGGATCTAACCGGGTTT[A/G]
TTGGGTTGAGTTTTGACTGATCTCCGGCGACTGCAGATGTCTTCGTACTG
  
Genomic location of solcap_snp_sl_22977  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20390 marker 20390
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)