Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker TG281

SGN-M204

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGATGAAAGGAAGAATATTGTGTTGCTGGCCTTTGAAACCATGGAAAAGATTGTACGGGAATATTTTC
GTTATATCACCGAGACTGAAGCATTGACTTTTACGGATTGTGTTAGATGCCTCATCACCTTCACAAACAGCAGATTCAACAGTGATGTCA
GCCTCAACGCTATTGCTTTTCTCCGTTTCTGTGCTGTCAAACTTGCAGAAGGGGGCCTTGTTAGCAATGAGAAAAACAAAAATAATGATT
CATCCATTCCAGTGGCCGAAAAAGAAGCTTCAGATGGGCTAATCTTCACAGATAAGGATGACTATATGTCTTTCTGGGAGCCTCTGCTCA
CAGGTATGTTGTTGCTTTTTTTTTTCCATACTTCTACCTTTCTGGAAACATTAAACCATTCTTATCAGTGAATCCTGAAGAGTTGTATCA
TGCAGTAACAAGTTGCTAATGCAGCAGGTTGTCCTTACACTTTTGTGGAATGACCAATTTTCTAAGCCAAATTAGTTCACCTCCT
Reverse sequence
TCCACAATTTTTTAACTATGAAATTCATTTACAGTTCAGAATATTCTCATAATCAAATTTCCTTGGGTCCTTCAGTCTTAAAGGTTATTA
TGCAGAAAGGAGGTGAACTAATTTGGCTTAAAAAATTGGTCATTCCACAAAAGTGTAAGGACAACCTGCTGCATTAGCAACTTGTTACTG
CATGATACAACTCTTCAGGATTCACTGATAAGAATGGTTTAATGTTTCCAGAAAGGTAGAAGTATGGAAAAAAAAAAGCAACAACATACC
TGTGAGCAGAGGCTCCCAAAAAGACATATAGTCATCCTTATCTGTGAAAATTACCCCATCTGAAGCTTCTTTTTCGGCCACTGGAATGGA
TGAATCATTATTTTTGTTTTTCTCATTGCTAACAAGGCCCCCTTCTGCAAGTTTGACAGCACAGAAACGGAGAAAAGCAATAGCGTTGAG
GCTGACATCACTGTTGAATCTGCTGTTTGTGAAGGTGATGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53880)
Chromosome
1
Position
40.10 cM
Confidence
uncalculated
Protocol
RFLP

Hexanal_content_hxa1_1 Pentanal_content_pna1_1 Titratable_acidity_ta1_1 Elasticity_ela1_1
Tomato QTL map

Map: Pepper-AC99   
Map version
34 (location: 8575)
Chromosome
1
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of TG281  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D204 marker 204
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)