SGN Marker T1490

SGN-M2041
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAW18TH
Arabidopsis best BAC match: AC008017.2
Arabidopsis position: 1.1400000
Arabidopsis identities: 0.661
Best GenBank protein hit: AAD55644.1
Evalue: 1.7e-74
Identities: 0.717
Description: ACE (adhesion of calyx edges) [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39641)
Chromosome
3
Position
161.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1490 was used as an overgo probe on plate 16 [well H10]

Plausible BAC Matches:   P098F24,   P148F24,   P157L14,   P051N01,   P130E19,   P297O15,   P269P13,   P080O24,   P061E15,   P024N17,   P021B10,   P042L09

 Overgo Sequences

A sequence
TTGGAAGCCCTCACATTCTGATGC
B sequence
GGTCCGATTCCACTAAGCATCAGA
AB sequence
TTGGAAGCCCTCACATTCTGATGCTTAGTG
Marker sequence
GTCACCTTTCAATGGATTCACTTATGATCACATCTATGGAACCAAGGTTG
GTGGGACCATATTCGACCACTTTGGACGTCGTCACTCTGCTGCTGAACTA
CTTGCCTCTGCTAATCCTAACAAGTTGGATGTTCTGGTGCATGCCACAGT
TCAAAAGATTGACTTTGATACATCAGGAAAGAAGCCACGGGCAGTGGGAG
TCATTTTCAAAGATGAAAATGGGAAAGAACACAAGGTATTTCTTTCGACT
AGGAAGGGAAGTGAGATTATAGTGTCATCTGGTGCGATTGGAAGCCCTCA
CATTCTGATGCTTAGTGGAATCGGACCAAAGGCCGAATTGGAAAAGTTCA
ACATCCCGGTGGTTCTTGACAATAAGTTTGTTGGTCAAGGAATGTCAGAC
AACCCCTTGAACACGATCTTCGTCCCCACAAATAGGCCCGTTGAACAGTC
ACTGATTCAGACCGTAGGGATTACGAAAAAGGGAGTCTATATTGAAGCAA
GTAGTGGATTTGGACAATCAGGAGATAGCATCAGTTGCCATCATGGAGTC
GCTTCAGCTGAGATTGTGCAACTGTC
Genomic location of T1490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2041 marker 2041
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)