SGN Marker T1492

SGN-M2043
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAW36TH
Arabidopsis best BAC match: AL022224.1
Arabidopsis position: 4.1050000
Arabidopsis identities: 0.808
Best GenBank protein hit: CAB79012.1
Evalue: 3.8e-26
Identities: 0.445
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39642)
Chromosome
2
Position
77.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1492 was used as an overgo probe on plate 12 [well A2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGATACTCCCGCTTCTCAGTTGG
B sequence
TCAGGATCTGCCAGTTCCAACTGA
AB sequence
AAGATACTCCCGCTTCTCAGTTGGAACTGG
Marker sequence
GCTCTCTCACTGACAGTAGAGTGGATAACGTTTCAAGAACCCAAATTCCA
TCGATGTATGAATCTTCTTTACTGAAATTCCACTAAATTTTTAGCTCACT
CTCAAGAATGGTTTCATCCACCATTCTAATTCAGCAACCGACGAACTTCT
TCCACCAGCCAGAGCTTCACCATCAGCTATGGAGAGGTCTGCAGCATGGA
TGTGTTGCATCATTGCAGAAACAACCTATTTTGGTATGTAATAGTAACAA
GAGAAACAGACCTTTGAGAGTTTCTTCAAGTGCTAATGGTGCTGTTACTT
CTTCCACTTTGGAGGCCTATGATTCTTCTCCGTCTCCTTCTGCATTTCCT
CTTTTTACACCCCCTTCTCAACCCCAAGATACTCCCGCTTCTCAGTTGGA
ACTGGCAGATCCTGATTTCTACAAAATAGGTTATGTTAGAAGTTTTCGAG
CCTACGGGATTGAATTCAGGGAGGGACCACATGGGTATGGAGTGTTTGCT
TCCAAAGACGTGGAACCTCTCCGTCGAGCTAGGGTAATAATGGAAATTCC
TTTAAAACTTATGTTAACCATAAGC
Genomic location of T1492  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2043 marker 2043
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)