SGN Marker T1493

SGN-M2044
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAW45TH
Arabidopsis best BAC match: AC009177.5
Arabidopsis position: 3.0090000
Arabidopsis identities: 0.754
Best GenBank protein hit: AAF27015.1
Evalue: 6.0e-75
Identities: 0.680
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39643)
Chromosome
1
Position
107.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1493 was used as an overgo probe on plate 1 [well H6]

Plausible BAC Matches:   P123A07

 Overgo Sequences

A sequence
ACTGCTGGTACAGTGAAGTTGTGG
B sequence
TGCCTCTAGTGATCTCCCACAACT
AB sequence
ACTGCTGGTACAGTGAAGTTGTGGGAGATC
Marker sequence
GGTCCTGACTAAGGATACTGCTGGTACAGTGAAGTTGTGGGAGATCACTA
GAGGCACTGTGATTCACAACTATGGAGAGGTTTCATTTGAGAAGAAGAAA
GAAGAACTTTTTGAGATGGTGAGCATCCCTGCATGGTTCACTGTGGACAC
TAAGCTTGGAAACTTGTCTGTACATCTGGATACACCACAATGCTTTTCTG
CTGAGATGTACTCTGCTGATCTCCACATTCCAGGGAAGCCTGAAGATGAC
AAGGTTAATTTGGCACGAGAAACCCTTAAAGGGCTGTTGGCTCATTGGTT
AGCAAAAAGAAAACAGAGATTTGGATCTCAAGCTTTTGCCAATGGGGAAG
CCCCAGCTGGAAAGGATGTACCTACAAGGAATCTGACCGCGTCAAAAATT
GAAGTGGACGGTAGTGCTGACAATGATGCTGCAGTATATCCTCCCTTTGA
ATTTTCAGCAGCATGCCCTCCATCAATTATTACTGAGGGTTCTCAAAGTG
GTCCATGGAGGAAAAAGATTACCGACTTAGATGGAACAGAAGATGAAAAG
GACATGCCATGGTGGGTAGTGGATTGTGTGATGAACAATCGG
Genomic location of T1493  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2044 marker 2044
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)