SGN Marker T1497

SGN-M2046
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAW74TH
Arabidopsis best BAC match: AB023038.1
Arabidopsis position: 3.0280000
Arabidopsis identities: 0.540
Best GenBank protein hit: AAB05376.3
Evalue: 7.0e-52
Identities: 0.538
Description: putative cytochrome P-450 [Nicotiana plumbaginifolia]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39645)
Chromosome
7
Position
35.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1497 was used as an overgo probe on plate 9 [well H9]

Plausible BAC Matches:   P124I19,   P103F01,   P291L08

 Overgo Sequences

A sequence
CTGCGTCATCAAGGAATCTATGGG
B sequence
GAAATCTATAGGGACGCCCATAGA
AB sequence
CTGCGTCATCAAGGAATCTATGGGCGTCCC
Marker sequence
GGAAACAAACAAACACATGGGCATGGCTATTGCAATTTTCATAGCTTTGG
CCATATTTTTTCCTTTCACTTTTTGGTGCCTAAAATTGCTCTACTTTGTA
TGGTGGCGTCCGAAAACAGTAGAAAATGAACTGCGTCATCAAGGAATCTA
TGGGCGTCCCTATAGATTTCTATTTGGAAATCTAAAAGAGATGATAGAGA
TGAATAAATTAGCCAAATCTAAACCCATGCCATTGCACCACGATTTCACA
CCTCGACTTAATCCATTGTTCTATGAACTCGCTACCACTTACAAGAAACT
ATACTTGTTTTGGCTAGGACCCATCCCTCGATTAACCATTTTGGATCCCA
AGTTAATAAAGGAAGTACTGTCAAACAAATCTGGTGAGTTCAGAAAACCA
AAAATCAGTGCTTTTCTGAAGCTATTTGTAACACGGCTAGGGACTTACGA
TGGTGAAAAATGGGCCAAACATCGAAAAATTCTTAATCCGGCATTCCACA
TGGAAAAATTGAAGGTGATGTTGGGATTATTTGTTGAATGTACGGATGAC
ATGATAAGCAGATGGGATAAGCTTACAGGTTC
Genomic location of T1497  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2046 marker 2046
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)