SGN Marker solcap_snp_sl_231

SGN-M20469

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71418)
Chromosome
5
Position
78.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67819)
Chromosome
5
Position
81.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64207)
Chromosome
5
Position
128.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56800)
Chromosome
5
Position
63.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGCCCTAGCAAATTATTCGCCATCTCCCTTAGCACATGCTTCAGTTCATT
  
3' flanking region
CCATCATTAATTACTGAACACCCGCTCAAAGGTGAACCATAAGTGTTGTC
SNP nucleotide
CG
SNPdb format
GGCCCTAGCAAATTATTCGCCATCTCCCTTAGCACATGCTTCAGTTCATT[C/G]
CCATCATTAATTACTGAACACCCGCTCAAAGGTGAACCATAAGTGTTGTC
  
Genomic location of solcap_snp_sl_231  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20469 marker 20469
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)