SGN Marker CT185

SGN-M205

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT185 image not available
Forward sequence
CTTTTTTTTTTTTGTGAAGACTTTCCCCCTGGCTCGGACAGAGGTTGATAACACAGCTGGTTTAGCAGCTGATTTCGTGTTCAGAATATT
GTTTGACAAAAGAATTGTTGTCAATGAAGAAAATGGTTGGTTATGTCAGAAAGGAAGACATCCTGGTTGATTATGGTGGTACTGTTGGAA
GTTTTAACCAGGTAATGGGACTTTGAGCATGGGAGCTCAGTTGTGTTTTGTTGTTCTTTTGCTGACACATTATAATGGTAAATGTTTGAA
ATAAATGATGTTACTATATGCTTGCTTTGGTTGGTATGAGAAGGAAAAAGCTTCTTCTCAGCAAATGATCTTCTGAATATACAGCCCTTC
GGCTGGAAAATGGCGACCCTTTATGATTGCTTCTATGTTGATGATATATACCC
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8576)
Chromosome
4
Position
61.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8577)
Chromosome
4
Position
76.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT185 was used as an overgo probe on plate 9 [well G8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCAGGTAATGGGACTTTGAGCATG
B sequence
AACACAACTGAGCTCCCATGCTCA
AB sequence
CCAGGTAATGGGACTTTGAGCATGGGAGCT
Marker sequence
CTTTTTTTTTTTTGTGAAGACTTTCCCCCTGGCTCGGACAGAGGTTGATA
ACACAGCTGGTTTAGCAGCTGATTTCGTGTTCAGAATATTGTTTGACAAA
AGAATTGTTGTCAATGAAGAAAATGGTTGGTTATGTCAGAAAGGAAGACA
TCCTGGTTGATTATGGTGGTACTGTTGGAAGTTTTAACCAGGTAATGGGA
CTTTGAGCATGGGAGCTCAGTTGTGTTTTGTTGTTCTTTTGCTGACACAT
TATAATGGTAAATGTTTGAAATAAATGATGTTACTATATGCTTGCTTTGG
TTGGTATGAGAAGGAAAAAGCTTCTTCTCAGCAAATGATCTTCTGAATAT
ACAGCCCTTCGGCTGGAAAATGGCGACCCTTTATGATTGCTTCTATGTTG
ATGATATATACCC
Genomic location of CT185  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D205 marker 205
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)