SGN Marker solcap_snp_sl_23706

SGN-M20537

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71449)
Chromosome
5
Position
31.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56868)
Chromosome
5
Position
4.15 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCATCATCGTTTACTCTAATGTCAAAATCGGTGGAAGGAGTTCTAGATGA
  
3' flanking region
AAGTATCCGGCATTCAAAGATAGGCATAAGCTGGCAGTAGAACGAGAGAA
SNP nucleotide
AG
SNPdb format
GCATCATCGTTTACTCTAATGTCAAAATCGGTGGAAGGAGTTCTAGATGA[A/G]
AAGTATCCGGCATTCAAAGATAGGCATAAGCTGGCAGTAGAACGAGAGAA
  
Genomic location of solcap_snp_sl_23706  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20537 marker 20537
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)