Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_23734

SGN-M20559

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71459)
Chromosome
5
Position
29.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67850)
Chromosome
5
Position
34.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64242)
Chromosome
5
Position
37.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56890)
Chromosome
5
Position
3.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACATCTTCTATACTACACATTTCTTCTTCCATTAATGGTGAAACAAAAT
  
3' flanking region
TTTATCTTCATCTTCTCAACTTAGAGGAAATTACCCTTTTCATCTCCCTA
SNP nucleotide
CG
SNPdb format
AACATCTTCTATACTACACATTTCTTCTTCCATTAATGGTGAAACAAAAT[C/G]
TTTATCTTCATCTTCTCAACTTAGAGGAAATTACCCTTTTCATCTCCCTA
  
Genomic location of solcap_snp_sl_23734  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20559 marker 20559
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)