SGN Marker T1514

SGN-M2058
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAY40TH
Arabidopsis best BAC match: AL096859.2
Arabidopsis position: 3.1090000
Arabidopsis identities: 0.814
Best GenBank protein hit: CAB51178.1
Evalue: 1.4e-28
Identities: 0.814
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39653)
Chromosome
9
Position
116.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1514 was used as an overgo probe on plate 14 [well B12]

Plausible BAC Matches:   P183J02,   P063P12,   P205P24,   P204O10

 Non-Plausible BAC matches

P048N19,   P155P21,   P251K16,   P032H16,   P317A08

 Overgo Sequences

A sequence
GAAGTTCAGTGAGGGATGGGAGGT
B sequence
CTTCCATCATGGTACCACCTCCCA
AB sequence
GAAGTTCAGTGAGGGATGGGAGGTGGTACC
Marker sequence
CGGAGCATCACCGGCGCCGCCGTATCCATCGCCTCCGCCACCATAACCGG
CGTACAGACTTTCCCTTTCATAGACATCTTTCAAAAATGGCAATTAGAAC
CATTTCAAGACTAAAAATTCCATCTTTGCTTCTTAAACACCTTTCAGGTT
CTCCATTACCATCAATTTCTTCCACCTTAACATCTTCTTCTTCATGTTCT
CCATCATGGGTTCCTGAGTTTTCTAGAAGTTCAGTGAGGGATGGGAGGTG
GTACCATGATGGAAGACCAAGAGGGCCACTATGGAGGGGAAAGAAATTGA
TTGGAAAAGAAGCACTTTTTGTGATTCTTGGGTTAAGAAGATTCAAAGAT
GATGAAGAAAAGCTTGACAAGTTTGTTAAAACACATGTGCTTAGGCTTCT
TAAAATGGATATGATTGCTGTACTTAATGAACTTGAACGCCAAGAAGAAG
TCTCTCTTGCTG
Genomic location of T1514  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2058 marker 2058
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)