SGN Marker solcap_snp_sl_23775

SGN-M20589

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71482)
Chromosome
5
Position
27.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67867)
Chromosome
5
Position
32.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64257)
Chromosome
5
Position
36.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56920)
Chromosome
5
Position
3.75 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAACTCACGCTCCCTGTCTTTATCTCTTACTCTATCCCTGTCATTCTCCA
  
3' flanking region
ACTACTCTCCCGAAATCTATCAACACTCTCCCTGTTATAATACCTGTCTC
SNP nucleotide
TG
SNPdb format
CAACTCACGCTCCCTGTCTTTATCTCTTACTCTATCCCTGTCATTCTCCA[T/G]
ACTACTCTCCCGAAATCTATCAACACTCTCCCTGTTATAATACCTGTCTC
  
Genomic location of solcap_snp_sl_23775  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20589 marker 20589
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)