SGN Marker solcap_snp_sl_23780

SGN-M20593

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71486)
Chromosome
5
Position
27.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56924)
Chromosome
5
Position
3.74 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGTACGCATTGCAACTGATATATGTGTTGCACTAAAAAATTTCCAGTAG
  
3' flanking region
TCAAAGTGAGCCTCGCAGTGCAATTTTTGAAATTTTATCGCCTTTTTCGT
SNP nucleotide
AT
SNPdb format
TGGTACGCATTGCAACTGATATATGTGTTGCACTAAAAAATTTCCAGTAG[A/T]
TCAAAGTGAGCCTCGCAGTGCAATTTTTGAAATTTTATCGCCTTTTTCGT
  
Genomic location of solcap_snp_sl_23780  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20593 marker 20593
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)