SGN Marker T1521

SGN-M2064
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAY93TH
Arabidopsis best BAC match: AC010164.2
Arabidopsis position: 1.0730000
Arabidopsis identities: 0.500
Best GenBank protein hit: CAB82745.1
Evalue: 1.3e-56
Identities: 0.583
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49451)
Chromosome
10
Position
63.94 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47385)
Chromosome
10
Position
77.92 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39659)
Chromosome
10
Position
78.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1521 was used as an overgo probe on plate 15 [well B12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAAGTTCTTCAGCCTCCGTGATCG
B sequence
ATCAAGCAAAACCCGGCGATCACG
AB sequence
CAAGTTCTTCAGCCTCCGTGATCGCCGGGT
Marker sequence
CAAGTATGGCAGGAACAAGTAATTATCCTTCTCAAACTCCGGCGCCTATG
CCGGTACCAAATCCGGTAGCAATTATAAATCCACAGTTCTGTGCACCGTA
TCCCGTTGATTTAAACGTTGTAAGGAAACTTATGACTTGGTCTGAAGGTG
CCTTCGGAGTTACCGATGTCAATGGAAACATTGTTTTTAAGGTTAAAGGC
AAGTTCTTCAGCCTCCGTGATCGCCGGGTTTTGCTTGATGCTGCCGGAAA
CTCTCTCGTCACTTTTCAACAAAAGATGTTGAGTGCTCATAGAAGATGGC
AAGTATACAGAGGAGAAAGCACAGACTCAAAAGATTTCCTTTTCAGTGTA
AAAAAATCTTCACTTCTTCAATTCAAAACCAAATTGGATGTATTCTTAGC
GCACAACACATCAGAAGACGTTTGTGATTTCAGAATTGAAGGCAGTTGGC
TTGAAAGATCATGTGTTATATATGCTGGAAATTCGTCGTCTATAGTTGCT
CAAATGCACAGGAAACACACTGCTCANAGTATACTA
Genomic location of T1521  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2064 marker 2064
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)