SGN Marker T1523

SGN-M2066
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.11
Tomato EST read: TPTAZ14TH
Arabidopsis best BAC match: AC002343.1
Arabidopsis position: 4.1230000
Arabidopsis identities: 0.855
Best GenBank protein hit: CAB81174.1
Evalue: 2.1e-64
Identities: 0.783
Description: "contains similarity to protein kinase domains (Pfam: pkinase.hmm, score: 227.04) [Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39661)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1523 was used as an overgo probe on plate 1 [well G8]

Plausible BAC Matches:   P261H03,   P203D03

 Overgo Sequences

A sequence
GCTTCTCGAAGAAGTCGGTTATGG
B sequence
AACTGTTGCACTCGCTCCATAACC
AB sequence
GCTTCTCGAAGAAGTCGGTTATGGAGCGAG
Marker sequence
CCGATGCTCTTCCGTTAATTTCAACGGTCATTTCCACAATCGGCAAGTTA
TACTTGACTTTTATAACAAAGCGATTTTGCTTATTCGGTCCCAGCGGCGA
TGGGCGGCGGCGGTCCCAGAAACTATTCGGCGAATCCAAATGATTACAAG
CTTCTCGAAGAAGTCGGTTATGGAGCGAGTGCAACAGTTTATAGAGCGAT
CTATCTTCCTTACAATGAAGTTATCGCAGTCAAGTGCTTGGATCTCGATC
GCTGTAACAGCAATCTGGATGACATACGCAGGGAAGCTCAAACTATGAGT
TTGATAGACCATCCTAATGTAATAAAGTCATTCTGTTCATTTGTTGTTGA
GAACTACCTATGGGTGGTGATGCCCTTCATGGCTGAAGGCTCTTGTCTAC
ATCTCATGAAAATAGCATATCCAGATGGATTCGAAGAATCTGCTATTTGT
TCTATGTTGAAGGAAACTCTCAAGGCGTTGGAATATCTCCATCGACATGG
GCACATACATCGAGATG
Genomic location of T1523  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2066 marker 2066
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)