SGN Marker T1524

SGN-M2067
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAZ20TH
Arabidopsis best BAC match: AC007354.2
Arabidopsis position: 1.0320000
Arabidopsis identities: 0.640
Best GenBank protein hit: CAA39708.1
Evalue: 2.2e-61
Identities: 0.734
Description: auxin-induced protein [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39662)
Chromosome
1
Position
34.50 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1524 was used as an overgo probe on plate 11 [well D4]

Plausible BAC Matches:   P023H04

 Overgo Sequences

A sequence
TGAAGCTAGGGTCACATGGTCTAG
B sequence
CCGATCCTGGAAACTTCTAGACCA
AB sequence
TGAAGCTAGGGTCACATGGTCTAGAAGTTT
Marker sequence
GACGACGGCGTTCGACCCGAGGGTGAAGCTAGGGTCACATGGTCTAGAAG
TTTCCAGGATCGGGCTGGGCTGTATGAGTATGTCCGGTAACTACGGCCCT
CCCAAGCCCGAGGCCGAAATGATCAAGCTACTTCATCACGCTATTGATAC
TGGAGTCACCTTACTCGATACTTCTGATGTCTATGGCCCTCTTACTAATG
AAATACTCATCGGCAAGGCTATTAAAGGGATAAGAGAGAGAGTGCAAATA
GCTACCAAGTTTGGTATACGTTTTGAAGATGGAAACAGGGGCATTTGTGG
TGAACCTGCGTATGTAAGGGCTTGTTGTGAGGCCAGCTTGAAGAGACTTG
ATATCGACTGCATTGATCTCTATTATGTTCATCGCATCGATACTCAGTTG
CCAATTGAAGTCACGATGGGAGAACTAAAAAAACTCGTTGAAGAGGGCAA
AATAAAATATATAGGTCTATCAGA
Genomic location of T1524  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2067 marker 2067
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)