SGN Marker solcap_snp_sl_24323

SGN-M20687

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71535)
Chromosome
7
Position
59.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67901)
Chromosome
7
Position
44.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57018)
Chromosome
7
Position
60.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGGCTCCTGAATGGCTTAGTGGAGTTATAACAGAGAAGGTAGACGTCTA
  
3' flanking region
AGCTTTGGCATTGTGATCTTGGAAATTTTGAGTGGAAGAAGACATTTTGA
SNP nucleotide
TC
SNPdb format
TTGGCTCCTGAATGGCTTAGTGGAGTTATAACAGAGAAGGTAGACGTCTA[T/C]
AGCTTTGGCATTGTGATCTTGGAAATTTTGAGTGGAAGAAGACATTTTGA
  
Genomic location of solcap_snp_sl_24323  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20687 marker 20687
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)