SGN Marker solcap_snp_sl_24361

SGN-M20689

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71536)
Chromosome
6
Position
23.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67902)
Chromosome
6
Position
32.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64291)
Chromosome
6
Position
41.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57020)
Chromosome
6
Position
34.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAGCTCCACAAATCAATTGGATGAAGAAGGAAGATTAATAGGGCCAGGTG
  
3' flanking region
GTGATGCGCCCCCGGTGCTTCCTGGCAGCAAGCAACGAATCGGACGAAAA
SNP nucleotide
AC
SNPdb format
TAGCTCCACAAATCAATTGGATGAAGAAGGAAGATTAATAGGGCCAGGTG[A/C]
GTGATGCGCCCCCGGTGCTTCCTGGCAGCAAGCAACGAATCGGACGAAAA
  
Genomic location of solcap_snp_sl_24361  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20689 marker 20689
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)