SGN Marker TG273

SGN-M207

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAACAGGAGAGTATTTCTTTTTGATGAACATGGAGAAAGATAACTTTTTTTAGGGGTGGAAAGTACATGGATTGCCATTCACATTCTTAT
TGCTTATAACTTGAGGAGGAGAAGGAAGACATGAATTAGCTGGGTTTTTTTTTTCTACAAAGGAATGATGGAGGATCTAGATCTTTTACT
TAGTCAAAGAAAACAGCCCTCCAAATACTGCACTAATATGTTAATCGTGCCGTAAGAAGGTTTTCAGGAGTAAATGGGCAAACCTGGCAG
TCTTATAATATTTAGAACAAGAAGATAGATAGGAGCAAACATTACATGTGCGATACTTGAGAAGCAGCCCATCCCACATTGAAGATTGCA
GCGAACACACTGTAACCAATAGTTTGCAGCATGGCCGAATCAGAACCAATAAGTTTGCAAGGCAAGCAACCGCCAAACATGGAAGAAAAT
GAGACAGCAACCAAGAGAGATCCTGCA
Reverse sequence
TTGTAATGCTCTCAGGTCAAGTTGCAGATGGATTGACTACTATATTTGCTGGGGAACTGGTATCTCTCAAGAACGTAACTACTACCTAAA
CTTTGTCCTTATTTCACCTACTGAGTTTTAAAGCATCTATTATATTTTTCTGGAAGGTGGATTAGATGACTTAAGAAAAACATGTTAAGA
CATTTTAATATCATTTCCTAAAAGAGATTATGAAGTCGTTGATAGATGAAAACATGCTCAACCATTTTCACGATTTCTCATCTAAACATA
TGTTTGTCTATTATAAAATGTATAGTTTTTCTTGTATGAGTATTCCAAATATATTATTTATGCAGCCATTTTCTTTATTATATATTGGTT
AGTTAAATGCAATAAGTAATTTTTGACATGAGAACAGCACATAGTCTTTTCAGGAGTAATAACAATTACGCCTCTTATCCCCAGATAATA
GTGCATACCTTTATTTTTTTTCTTTATTATTGAACCTTCTAGCTAATA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1500251.4e-81164 (34.4% of RFLP seq)+
SGN-U1500242.9e-27101 (20.3% of RFLP seq)-
SGN-U150025498 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53530)
Chromosome
1
Position
60.14 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43853)
Chromosome
1
Position
70.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43595)
Chromosome
1
Position
53.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43314)
Chromosome
1
Position
72.90 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42429)
Chromosome
1
Position
78.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40852)
Chromosome
1
Position
85.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Eggplant-LXM 2002   
Map version
29 (location: 8580)
Chromosome
1
Position
94.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8579)
Chromosome
1
Position
35.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8581)
Chromosome
1
Position
93.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG273 was used as an overgo probe on plate 14 [well H4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCCATCCCACATTGAAGATTGCAG
B sequence
GGTTACAGTGTGTTCGCTGCAATC
AB sequence
CCCATCCCACATTGAAGATTGCAGCGAACA
Marker sequence
CAACAGGAGAGTATTTCTTTTTGATGAACATGGAGAAAGATAACTTTTTT
TAGGGGTGGAAAGTACATGGATTGCCATTCACATTCTTATTGCTTATAAC
TTGAGGAGGAGAAGGAAGACATGAATTAGCTGGGTTTTTTTTTTCTACAA
AGGAATGATGGAGGATCTAGATCTTTTACTTAGTCAAAGAAAACAGCCCT
CCAAATACTGCACTAATATGTTAATCGTGCCGTAAGAAGGTTTTCAGGAG
TAAATGGGCAAACCTGGCAGTCTTATAATATTTAGAACAAGAAGATAGAT
AGGAGCAAACATTACATGTGCGATACTTGAGAAGCAGCCCATCCCACATT
GAAGATTGCAGCGAACACACTGTAACCAATAGTTTGCAGCATGGCCGAAT
CAGAACCAATAAGTTTGCAAGGCAAGCAACCGCCAAACATGGAAGAAAAT
GAGACAGCAACCAAGAGAGATCCTGCA
Genomic location of TG273  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D207 marker 207
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)