SGN Marker T1527

SGN-M2070
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.04
Tomato EST read: TPTAZ38TH
Arabidopsis best BAC match: AL035678.1
Arabidopsis position: 4.1710000
Arabidopsis identities: 0.814
Best GenBank protein hit: AAC64606.1
Evalue: 2.1e-42
Identities: 0.750
Description: Tic22 [Pisum sativum]
Comment: component of chloroplast import apparatus
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39664)
Chromosome
6
Position
9.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1527 was used as an overgo probe on plate 3 [well D1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGGAAGTGAGAGGTGGAGCTAAG
B sequence
GTGTCAACGGAACTACCTTAGCTC
AB sequence
AAGGAAGTGAGAGGTGGAGCTAAGGTAGTT
Marker sequence
GCATCATTCAAATTGGACGAATAGTGGAATACCGACGTCGGAGATAATCG
GAAACTATGGTGGATGCAATTAGGTCATCGGAGGTGCAAGATAACTCCAA
TCGAGAACAGATCGACAAATTCACTGATATCCACCCAAGGAATCCTTTAT
ATCTTCATCCATCCGATACTCCAGGTACGGTTGCGGAAGAAGGAAGTGAG
AGGTGGAGCTAAGGTAGTTCCGTTGACACTTGATCAGGTTTACATGTTGA
AGGTTGAAGGAATCGCATTTCGTTTTTTGCCAGATCCTGTTCAAATTAAG
AATGCAATGGAGTTAAAAGCTTCTGATGTAAAGACTGGATTTGATGGAGT
CCCTGTTTTCCAGTCAGATCTCCTAGTTGTGAAAAAGAGAAACAGACGAT
ACTGTCCAATATACTTTCGAAAGGAGGATATAGAAAAGGAGTTATCGTCA
AGGGCATTGAGAGGATCTAGTGTCTCTCANCACATTATGGTAGGGACTTT
GGAAGAT
Genomic location of T1527  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2070 marker 2070
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)