SGN Marker T1530

SGN-M2072
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.
Tomato EST read: TPTAZ53TH
Arabidopsis best BAC match: AB018113.1
Arabidopsis position: 5.1550000
Arabidopsis identities: 0.753
Best GenBank protein hit: BAA82068.1
Evalue: 5.4e-26
Identities: 0.779
Description: nClpP4 [Arabidopsis thaliana]
Comment: component of procaryotic protease complex
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39665)
Chromosome
8
Position
42.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1530 was used as an overgo probe on plate 12 [well D7]

Plausible BAC Matches:   P124K03,   P012O12,   P041J09,   P001K22,   P115F21

 Overgo Sequences

A sequence
TCAATCTCCGCCATACCTCTCTTC
B sequence
GTGGGTGAAAGCTTAGGAAGAGAG
AB sequence
TCAATCTCCGCCATACCTCTCTTCCTAAGC
Marker sequence
GAAATTCTCCTCTCTACCAAAGGAGTCCCTAACTCTTTCTACTTCTCTAT
CTCCTCACTGATCCTCTTTCAATCTCCGCCATACCTCTCTTCCTAAGCTT
TCACCCACTTTTTCACCATACCCATCTCGCAAAACACCCTTATCCCTCAA
ATCTTCACTCACTTCTCACCAATCCACTTCAAAACCCCTTTCTGATTCTC
ATCTAGCTGCGGATGATAAATTGTCCTTGCTACTTGCCTCTGCTCCTCAG
TCCCCGGAGATGGCTATGCGTGGTGCTGAAGGAGACGCAATGGGGCTGTT
GCTTAAGGAGAGGATAATTTTCTTGGGTAGTAGCATTGATGACTTCTTCG
CTGATGCTATTATTAGTCAGTTGTTGTTGTTGGATGCTCTGGATTCCACT
AAAGATATTAGGCTCTNTATTAATTGCCCTGGTGGCTCACTCAGCGCAAC
AATGGCTATCTTCGACGTTGTGCAGTTGG
Genomic location of T1530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2072 marker 2072
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)