SGN Marker T1540

SGN-M2079
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTBA88TH
Arabidopsis best BAC match: AB005244.2
Arabidopsis position: 5.0420000
Arabidopsis identities: 0.720
Best GenBank protein hit: BAA93453.1
Evalue: 6.0e-77
Identities: 0.770
Description: acyltransferase homolog [Petunia x hybrida]
Comment: unknown acyltransferase
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39671)
Chromosome
3
Position
59.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1540 was used as an overgo probe on plate 6 [well H4]

Plausible BAC Matches:   P185B14,   P147D24,   P030A11,   P061I16,   P100A16,   P030A12

 Overgo Sequences

A sequence
ACAGCTCACCAAGCTTAAAGACGG
B sequence
TAATCCCATTGCCAGCCCGTCTTT
AB sequence
ACAGCTCACCAAGCTTAAAGACGGGCTGGC
Marker sequence
GGCTAATCTTACTAATTTTCAAGAAGGGATTAAGAAATTCCAAGATTTGA
TACCTTATAACAAAATCTTGAATTTAGAAGGACTGCACAGGCCTCTACTC
GCCGTACAGCTCACCAAGCTTAAAGACGGGCTGGCAATGGGATTAGCATT
TAATCATGCTGTGCTGGACGGTACCTCCACGTGGCACTTCATGACTTCCT
GGGCCCAGCTCTGTAGTGGGGCCACCTCCATCTCGGTCCCACCTTTCCTC
GAACGAACTAAAGCTCGTGACACTCGAGTCAAACTCAACCTATCTAAGCC
ATCCGACGCACCGGAACATGCCAAGTCGGATCCACCTATGCGTGACAGGG
TGTTCAAGTTTTCCGAATCAGCAATTGATCAAATCAAGTCAAAAGTCAAT
ACGAACCCACCAGAAGAAGGCACAAATAATACGTCGTCGTTTTCTACTTT
CCAATCCCTCTCCGCGCACGTGTGGCTAGCTGTCACACGTGCGAGGCAGC
TCAAACCGGAGGAATACACGGTTTACACCGTGTTCGCTGATTGCCGTANA
AGAGTCGATCCGNCGATGCCGGA
Genomic location of T1540  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2079 marker 2079
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)