SGN Marker TG419

SGN-M208

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAAATTCTCCCATACTTCCTCCAAATAATGGTCCAAATGCAGGAAGAGGGTATCAAACTCTTGGAGGTGGTATGTCTTTCTAGATACTAG
TATTTCCTCCTTCCTGATATATGACATAATTTTTTCACTGAATATTGAGGAAGTTGGTAGACTTGCATGTCATTTTGGTGGTGGGTGATG
ATTGCATTGAACTTTTCTATCGGACTTGTTTGAAAAATGCAAATAGAATTATTCAATAAGAAAACATCATTTATGAGTTTGAAGTTCAAT
TTGTTTTAATGAATTTGATTTTGAGACTTGCAGAGGACTTAGAGTTAGTATGACTTGAATATTTTTAGCAAATATATATTATTTGTTGAA
AATGTATATAGAACTTTTTTCCAGTAAAGGCTGGGCTTGGGATGTATATCTATATGTATATTAGTATCTCACTAAAGAAGGAGGGTATGG
CCTAACCTT
Reverse sequence
CCTTCCCTTTCCTTAACAGTGTGATGTTAACAATGGATTCCTCTCTGTGGTCTACAAAATATTACCTAAATAGATCCCATCGATATCACT
ATATGGTCATGTCTCAGAAGTATGAATCTTTCTTTTTCCTCAATCTTTCAACAGTAAAAACACCACTCAGAATTTACAAATATGCAGTTT
GTGCTCTACTAAAATGAGGGAAGACTTTTTCAGCAAGAAAAAATTTCAATTGGAGCATTATATACACCGTTAAGTGATATTGTTTCCAAA
TTAGCTACAGTGAAACCATAAACAATAAAGCAATAGTATTATGAGACAAATGGTTATTTAAGGGTTTGTTTTCTTTTGGATACATGTTAG
TCAAGATAGTAATAATTTGTTGTTTTATGCAATAAGTTTATCAACCAAATTAAGGAGCAAGATACCATGCTTTTACACACACCCAGAGTC
TTTCAGTTCACTTAGTTGT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53306)
Chromosome
5
Position
39.80 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Pepper-AC99   
Map version
34 (location: 8583)
Chromosome
5
Position
25.73 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8582)
Chromosome
5
Position
67.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG419 was used as an overgo probe on plate 5 [well G1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P292C20,   P291A03,   P221P13,   P325F13,   P318D17,   P189H12,   P325N02,   P046G07

 Overgo Sequences

A sequence
GTCCAAATGCAGGAAGAGGGTATC
B sequence
CCACCTCCAAGAGTTTGATACCCT
AB sequence
GTCCAAATGCAGGAAGAGGGTATCAAACTC
Marker sequence
CAAATTCTCCCATACTTCCTCCAAATAATGGTCCAAATGCAGGAAGAGGG
TATCAAACTCTTGGAGGTGGTATGTCTTTCTAGATACTAGTATTTCCTCC
TTCCTGATATATGACATAATTTTTTCACTGAATATTGAGGAAGTTGGTAG
ACTTGCATGTCATTTTGGTGGTGGGTGATGATTGCATTGAACTTTTCTAT
CGGACTTGTTTGAAAAATGCAAATAGAATTATTCAATAAGAAAACATCAT
TTATGAGTTTGAAGTTCAATTTGTTTTAATGAATTTGATTTTGAGACTTG
CAGAGGACTTAGAGTTAGTATGACTTGAATATTTTTAGCAAATATATATT
ATTTGTTGAAAATGTATATAGAACTTTTTTCCAGTAAAGGCTGGGCTTGG
GATGTATATCTATATGTATATTAGTATCTCACTAAAGAAGGAGGGTATGG
CCTAACCTT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG419  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D208 marker 208
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)