SGN Marker solcap_snp_sl_2508

SGN-M20841

Synonyms  
SGN-U582420_snp113
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71624)
Chromosome
1
Position
99.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67962)
Chromosome
1
Position
90.64 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64356)
Chromosome
1
Position
146.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57172)
Chromosome
1
Position
82.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACCCAGATGTCACAGAGTTTGAAGGTACTGAAAGTAATCTTCTGTTGGA
  
3' flanking region
AATAGAATTTGCCTCCACGCCATTGTTGAGCTTCCTGTGAATTGAGAGCT
SNP nucleotide
CG
SNPdb format
AACCCAGATGTCACAGAGTTTGAAGGTACTGAAAGTAATCTTCTGTTGGA[C/G]
AATAGAATTTGCCTCCACGCCATTGTTGAGCTTCCTGTGAATTGAGAGCT
  
Genomic location of solcap_snp_sl_2508  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20841 marker 20841
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)