SGN Marker solcap_snp_sl_25153

SGN-M20851

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71630)
Chromosome
6
Position
6.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57182)
Chromosome
6
Position
2.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGCATCCCTCAAGGACCTCAATTCCGTACCTTTGAGAGCAATTCATAT
  
3' flanking region
AAGGTAATGATGGATTACGTGGATATCCAGTTTCAAAAGGTTGTGGCAAA
SNP nucleotide
AG
SNPdb format
GATGCATCCCTCAAGGACCTCAATTCCGTACCTTTGAGAGCAATTCATAT[A/G]
AAGGTAATGATGGATTACGTGGATATCCAGTTTCAAAAGGTTGTGGCAAA
  
Genomic location of solcap_snp_sl_25153  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20851 marker 20851
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)