SGN Marker TG427

SGN-M209

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
950
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG427 image not available
Forward sequence
AATTGATAGTCCACACATATCAAACCTCATATAGTTCTCCTCTTCAACTGGGTATTCAATATGATAATCAAATCAGAACAGTTCCTTTTG
CTGTAATACAACTGAAATGCATTTCACATAGCCCCAAAATACCACATGAAAGAACGGAAAAAGTATCATAATTTCCAAACAGAGTATAAT
AGACAAAAGGAAGTGAACAACACATTTTCCACTAACACATAATAACATCCAGATATTGCATTTGCCTTCATTAGCTCTAAAAAAGTATTT
GACTATCAAGCATGCTGGTTATTGAAAGGCAAAGGGTAATTAACAAACAACGAAAAAGGAAAAAGAACTATGATATGGATAAAATTCATT
AATCTACAAAGCAGTTTAATCTAAATCATAAAGTAGTGACTACATAAACTTACTAGAAATAGTCAATGGCATCAATTTACGGGCCCTTAA
TAAAAAGATATCGCTCAAGTCTCCAAGAGCCCTCATTT
Reverse sequence
ACTCACTATAGGGAGACAGCTTGCATGCCTGCAGGGTGTGAAAGACCTGGCATGTGGGAACTCTGTAATGAATTTGGAAGCAATAGAGAA
TCACTACAAGTCCAATGGTATTAACATCAAACTGGATCCACAAATGAAAGTACCCTGCTCGGTATGTCATAGTTTCCTGTTCTTTGGCAG
GAATACTAGTCCAAATATGAATGCTGCTTTCTATTTTAGTGGGCGTGTTCCTCCTAAAGCAAATGTTGCTACTTTATAAAATGGTGGAGG
GGAAAGGAGTTAAAATATTTACTGTGTAGAGCTAGAAGTTGGAGGTTTGGCTGGAGGTTGTTCGTGTCCTCTGTTTCTATTGTTCTGCAT
TCTTAAGCTTTTGAGGTTGTTTGGGTAAATCTAAATTTAGGGTTTAATTGTCAAATTTTTAAAATAAAAATGAGGGCTCTTGGAGACTTG
AGCGATATCTTTTTATTAAGGGCCCGTAAATTGATGCCATTGACTATTTCTAGTAAGTTTATGTAGTCACTACTTTATGATTTAGATTAA
ACTGCTTTGTAGATTAATGAATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1686642e-126231 (47.3% of RFLP seq)+
SGN-U1504588.4e-65124 (22.0% of RFLP seq)-
SGN-U1686645e-97178 (31.6% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53314)
Chromosome
4
Position
49.64 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8584)
Chromosome
4
Position
63.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG427 was used as an overgo probe on plate 9 [well E10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGGGCCCTTAATAAAAAGATATCG
B sequence
CTCTTGGAGACTTGAGCGATATCT
AB sequence
CGGGCCCTTAATAAAAAGATATCGCTCAAG
Marker sequence
AATTGATAGTCCACACATATCAAACCTCATATAGTTCTCCTCTTCAACTG
GGTATTCAATATGATAATCAAATCAGAACAGTTCCTTTTGCTGTAATACA
ACTGAAATGCATTTCACATAGCCCCAAAATACCACATGAAAGAACGGAAA
AAGTATCATAATTTCCAAACAGAGTATAATAGACAAAAGGAAGTGAACAA
CACATTTTCCACTAACACATAATAACATCCAGATATTGCATTTGCCTTCA
TTAGCTCTAAAAAAGTATTTGACTATCAAGCATGCTGGTTATTGAAAGGC
AAAGGGTAATTAACAAACAACGAAAAAGGAAAAAGAACTATGATATGGAT
AAAATTCATTAATCTACAAAGCAGTTTAATCTAAATCATAAAGTAGTGAC
TACATAAACTTACTAGAAATAGTCAATGGCATCAATTTACGGGCCCTTAA
TAAAAAGATATCGCTCAAGTCTCCAAGAGCCCTCATTT
Genomic location of TG427  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D209 marker 209
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)