SGN Marker T1551

SGN-M2090
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTBB57TH
Arabidopsis best BAC match: AC008007.7
Arabidopsis position: 1.0940000
Arabidopsis identities: 0.636
Best GenBank protein hit: BAA97063.1
Evalue: 4.8e-67
Identities: 0.836
Description: "contains similarity to DAG protein, chloroplast precursor~gene_id:K15M2.14 [Arabidopsis thaliana]"
Comment: unclear
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49454)
Chromosome
10
Position
1.63 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47388)
Chromosome
10
Position
11.38 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39675)
Chromosome
10
Position
9.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1551 was used as an overgo probe on plate 15 [well F6]

Plausible BAC Matches:   P275L04,   P276B16

 Overgo Sequences

A sequence
TTGAGCACTGGCTTGTTGTGATGG
B sequence
TCACCTTCAGGCTTCTCCATCACA
AB sequence
TTGAGCACTGGCTTGTTGTGATGGAGAAGC
Marker sequence
AGCAGAAATGGCGACTCGTTATCTTACTCGTTCTCTACTCACTACTCTCT
CTCGCTCATACACTACTGTTTCTCTCTCTACACCTCTTCCATCTTCTTTC
TCTCTCCTCCGGTTTCGTCCTCTCATCGCCGTCGCAGCGAATCTTCGAAC
CTTTACTCCGGCAACGTTAACGGCGGCGACGTCGTTGAGAGGTTTCGCGA
CTCGTCAAACGTCGTCGTCGTTGAATGACCCGAACCCGAACTGGTCTAAT
CGTCCACCGAAGGAGACGATTTTGCTTGATGGATGTGATTTTGAGCACTG
GCTTGTTGTGATGGAGAAGCCTGAAGGTGATCCTACAAGAGATGAGATTA
TTGATAGGTACATCAAAACTCTTGCTACGATTGTCGGAAGCGAGGAGGAA
GCAAGAATGAAGATCTACTCTGTCTCGACAAGACATTACTTTGCATTTGG
AGCTCTTGTATCCGAAGAACTTTCTTACAAGCTCAAAGAATTGCCAAAGG
GTAGATGGGTGCTTCCTGATTCCTACCTGGATGTTAAAAATAAAGATTAT
GGAGGAGAACCTTTTATTAATGGGCAGGCTGTACCATATGACCCGAAATA
CCAC
Genomic location of T1551  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2090 marker 2090
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)