SGN Marker solcap_snp_sl_25227

SGN-M20903

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67988)
Chromosome
6
Position
0.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64382)
Chromosome
6
Position
2.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57234)
Chromosome
6
Position
1.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATCCAAATCATCAGGGAAACCAAAAACCAGACCTGAAAAGCTAGGTGAA
  
3' flanking region
CGACGTCGGTATCAGCATCGGCGCTGTGTTCACTGCCGCTGCTGATGTAA
SNP nucleotide
AG
SNPdb format
GATCCAAATCATCAGGGAAACCAAAAACCAGACCTGAAAAGCTAGGTGAA[A/G]
CGACGTCGGTATCAGCATCGGCGCTGTGTTCACTGCCGCTGCTGATGTAA
  
Genomic location of solcap_snp_sl_25227  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20903 marker 20903
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)