SGN Marker T1554

SGN-M2091
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBB81TH
Arabidopsis best BAC match: AB026648.1
Arabidopsis position: 3.0850000
Arabidopsis identities: 0.742
Best GenBank protein hit: CAA66822.1
Evalue: 7.3e-32
Identities: 0.613
Description: unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49455)
Chromosome
2
Position
49.61 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47389)
Chromosome
2
Position
156.93 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39676)
Chromosome
2
Position
142.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1554 was used as an overgo probe on plate 11 [well A5]

Plausible BAC Matches:   P265A18,   P177F12,   P328L18,   P051O23,   P233G16,   P131F11,   P177D18

 Overgo Sequences

A sequence
TCCAAGAAGAACCCAGATGGCTAG
B sequence
GAGCAAGTGGTTTCCACTAGCCAT
AB sequence
TCCAAGAAGAACCCAGATGGCTAGTGGAAA
Marker sequence
GCATGGATCCAAATCCAAACAACAGCAGCAGCAGCAACCCGACAACTTTT
CAGGAAACATGGCTACCGCTGCATCTACTTCTGGAGGATCCTCCAAAAAG
GTGAACAACTCCGGCAGCAGTCGAGAAAGTTCACGACATCATAACAGTGA
TATAATCTGACTGCACGGACAAGGAAAACCAGCTAGGACCAATGATCCTT
CCAGCGGAAGAGACCAGTTTGGCTTTAACAGTCCCCAAGGAGTTGTTACC
CGCTCAGCTCCAAGAAGAACCCAGATGGCTAGTGGAAACCACTTGCTCAA
TTTTCAGTATGATCCCATTTCTCGTCCACAATCTAGGTTGCCTCCTCCTA
GGAGATACGTCAAGAGGAAGTCTTACAACAAAGACTCGTTTCTTCAAGCA
AATTACAAGTTTGTTCTGTTGGATTCAGGCTATTACACGCCTGACTCGAT
GGATCCAGACAAAATGTTACAGTGGGAGGATATTGCTTGTGTGAGATATT
CCACTCCATTTCATGTGCAAAGCCCCATATGCTTAGAAGATCCTCTTTGT
CCTCAAATAAC
Genomic location of T1554  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2091 marker 2091
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)