SGN Marker T1555

SGN-M2092
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTBB82TH
Arabidopsis best BAC match: AB013389.1
Arabidopsis position: 5.2970000
Arabidopsis identities: 0.704
Best GenBank protein hit: BAB10929.1
Evalue: 5.1e-48
Identities: 0.687
Description: apospory-associated protein C-like [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39677)
Chromosome
2
Position
88.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1555 was used as an overgo probe on plate 11 [well F7]

Plausible BAC Matches:   P213A01,   P030A21,   P019I01,   P005O22

 Overgo Sequences

A sequence
GATGGCAGCATTGTCTATGACCTG
B sequence
TAAGGGAGAGCAAGACCAGGTCAT
AB sequence
GATGGCAGCATTGTCTATGACCTGGTCTTG
Marker sequence
GACTTACTTTTTGCAAATCCTTAGTAATTTTGCCATCAAATAGAAGATGG
CAGCATTGTCTATGACCTGGTCTTGCTCTCCCTTAACCTCCTCAAAATTT
CGGCGAGTCAATCGATATTCAGGAATGGCATTTGCAAGTGTGAAATCTAC
TGAAGGGTTGGGGAATTTACCCAAGGTCGTTTTGACTTCTCCTCATGGAA
GTGAGGCTGAGCTATATCTATTTGGAGCTTGTGTCACATCTTGGAAAGTA
GACAGTAAAGATCTACTTTTTGTTCGACCAGATGCTGTATTCAATGGTCA
GAAACCAATCAGTGGAGGAATACCACATTGTTTCCCACAATTTGGACCTG
GCCCAATCCAGCAGCACGGATTTGGAAGGAACATGAATTGGTCCCTTGTT
AGCTCTGAAAGTGTGGAGGAGAAACCTGTTGTTACTGTGGAGCTAAGGGA
TGGGCCTTATAGCCGAGCAATGTGGGATTATAGCTTCCATGCTCTTTACA
AGATCACTCTTGATAAGAAGACCCTGTCAACGGAAC
Genomic location of T1555  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2092 marker 2092
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)