Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T1556

SGN-M2093
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBB86TH
Arabidopsis best BAC match: AB009053.1
Arabidopsis position: 5.2730000
Arabidopsis identities: 0.840
Best GenBank protein hit: BAB10850.1
Evalue: 4.2e-33
Identities: 0.494
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49456)
Chromosome
6
Position
40.36 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47390)
Chromosome
6
Position
63.95 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39678)
Chromosome
6
Position
59.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1556 was used as an overgo probe on plate 3 [well D8]

Plausible BAC Matches:   P310B09,   P077M23,   P197N20,   P174A03

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CATGGCGTCTCAATCAGATTCTCC
B sequence
GTTTACGGAGTTGGGTGGAGAATC
AB sequence
CATGGCGTCTCAATCAGATTCTCCACCCAA
Marker sequence
TAATCAATTCGTCTGAGTTCAATAGAGTTGGATAACATGGCGTCTCAATC
AGATTCTCCACCCAACTCCGTAAACGAGAATACCCAGAATCCAGCTTCGC
AACCAGCAGCTGAAGATCATCAAGGTCCCAAGCCTGAGGCTGCAAGTGGG
AGCTCTCCAGCTTCTGTGTGAGGAAACTCGGAACCAATTCGGGAGGACCA
AGTCCAGAATGCTATGAAATTTCTTTCACATCCAAAAGTTACGGGATCTC
CAGGCATGTATAGGCGTTCTTTTCTTGAGAGGAAGGGGCTTACAAAGGAG
GAAATTGACGAGGCCTTTCGTGGAGTTCCTGATCCTACCCCAACTGTTAC
TAGCACACAGCCAGTTGCTGCTCATGAAGATGGGACACAGAAGCCTTCAT
CGACTAGTACACCACAGGCTGCTTTACAAAATCTGCAGCTTGCGTCAGCT
CCGAGCAATAGCATGAAAAAAATGGGGTGTCTCTCTCATTTCCATTGGAC
TCATGCAGTTATTGCTGTAGGTCTACTCACTGCTTCTGGAGCTGGAACAG
CTGTACTTTTCAAGAAATCTATTATT
Genomic location of T1556  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2093 marker 2093
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)