SGN Marker solcap_snp_sl_25277

SGN-M20940

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68005)
Chromosome
6
Position
0.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64400)
Chromosome
6
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57271)
Chromosome
6
Position
1.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATAAGATTGTTGATTTCATCAAGTTTGATGTTGGGAATGTTGTGATGGT
  
3' flanking region
ACTGGAGGTAGAAACAGGGGACGTGTTGGTGTTATTAAGAACAGGGAGAA
SNP nucleotide
TG
SNPdb format
AATAAGATTGTTGATTTCATCAAGTTTGATGTTGGGAATGTTGTGATGGT[T/G]
ACTGGAGGTAGAAACAGGGGACGTGTTGGTGTTATTAAGAACAGGGAGAA
  
Genomic location of solcap_snp_sl_25277  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20940 marker 20940
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)