SGN Marker solcap_snp_sl_25402

SGN-M20998

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71646)
Chromosome
2
Position
33.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57329)
Chromosome
2
Position
36.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGGAGAAAGACGACGAGCTTAAGCTTCAGTTCCTAACTTATATTTGAAT
  
3' flanking region
CATTTGTAGCTTTTTCTAAGTTCAATCCCGAGGTTCTGAAATCCATGAAC
SNP nucleotide
TC
SNPdb format
GAGGAGAAAGACGACGAGCTTAAGCTTCAGTTCCTAACTTATATTTGAAT[T/C]
CATTTGTAGCTTTTTCTAAGTTCAATCCCGAGGTTCTGAAATCCATGAAC
  
Genomic location of solcap_snp_sl_25402  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20998 marker 20998
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)