SGN Marker solcap_snp_sl_25403

SGN-M20999

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71647)
Chromosome
2
Position
33.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68027)
Chromosome
2
Position
48.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64422)
Chromosome
2
Position
67.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57330)
Chromosome
2
Position
36.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGGTGGAAAATGCTGGAGGGTTTTGGACGGATGCAACTGTTGCTACAAC
  
3' flanking region
GAGTTTAACAGTGACGTTACAAGGAATGATGCTTCTCTGGTGTGATTTCC
SNP nucleotide
TC
SNPdb format
TGGGTGGAAAATGCTGGAGGGTTTTGGACGGATGCAACTGTTGCTACAAC[T/C]
GAGTTTAACAGTGACGTTACAAGGAATGATGCTTCTCTGGTGTGATTTCC
  
Genomic location of solcap_snp_sl_25403  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20999 marker 20999
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)