SGN Marker TG421

SGN-M21

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TATATAATCGATCTGTTCTATGAACTTCAAATTACTTATTTTTTGTGATTTTTTTGATATTTTTTTTGACTTTGGATGACTTAGATCTGT
TGTTTAGTTCATTTTGACTTGAACTTTGAGTTGCTTATCGCTTTAGCCTTAGATCTAGTTATTAACTGTTAGTTTTATGATTTAGTGGCT
GATCCTTGTTAATGAGATTTGTAGAGTTCTGATTTCCTTATAAAATGTTGTTTTGAGTATTTAGATGAATAAAAAGTAGTTTAAGCTACA
ACTATTAAGAGAGTATTACTTTGTTCGCGGTAGTTGATGTTGCTGATTCATCTGCTTGATGTATTTGTTGTTATTTTACCATTTAGTATT
AACTGTATTAGCTTGCAAGGTTGAGATTTGGATCTTTGTTGCTCCGATTTGTAACTTGAAACAATTAAAATGATGACCGTGTTCTTTTCT
GTTGTTGTTTGCTTTGATTTATATTTCTAATTTGATTTATTGATTGGAAAGAGAAGATGAACTAATTTAAGATTGAGATTTAGTTGTTAT
TAGCATGATTGAATTGATG
Reverse sequence
TGTTGGACATTGTGCAATATACGAGGTGCGAAACTTAAAAATTGCAAGGAATGAACAAAGGTGTATAATCATAGCCTGACCTTGCAGTTG
GGAGCTGCATGCTTCTCAAGTGCAGATGCCTGGGACTTGTAAATAGACACATTCTTTGACATCACATCTTTCCTTTCCATGCCTTCTTTC
CTGGGGAAACCTCCAACCATGACCGCAACGTTGACACCGGTGCATGCCTCAACAGCATCAGTTGTGGCAACGACACCTAACACATACATA
GAAGAACACACCATTTAAACCAATTTCATTTACAAAAAGTGTAAGATAATAAGCAACTGCACCAACCCTTAAGAAGAGGGAAGGCAGCAT
CTACTAATTCCATCTTCACTCCATTCAGTGCCTCAGCAGCAGGTGGAATATCCAACATGTGGAGAATTACAGGCTGATCTGCGCCCAACA
TCACTCCCCTGGCAATCATAGGCACCAAGGCATATCCAATTTGTCCTGAAAAACAAATCAACATTACCATGTTAACATAACATTCCAACC
AATTCATGATTTTGAAACCAATAAAATATTTATTATCTCACAATTACATTTTCCAACTATCGAAAAGAAATTATAAAACCTCAAAACAGA
TTCCAAAGACACTGACAAGCATATCTTCATAACTATCTAGC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1441601.4e-88164 (24.4% of RFLP seq)-
SGN-U1441601.5e-97179 (26.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53552)
Chromosome
9
Position
66.67 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53309)
Chromosome
9
Position
84.38 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50386)
Chromosome
9
Position
65.03 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48320)
Chromosome
9
Position
81.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43867)
Chromosome
9
Position
66.20 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43610)
Chromosome
9
Position
75.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43329)
Chromosome
9
Position
81.50 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42459)
Chromosome
9
Position
89.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40869)
Chromosome
9
Position
86.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40038)
Chromosome
9
Position
83.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7765)
Chromosome
9
Position
81.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Pepper-FAO3   
Map version
31 (location: 7770)
Chromosome
3
Position
31.37 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Eggplant-LXM 2002   
Map version
29 (location: 7767)
Chromosome
9
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7766)
Chromosome
9
Position
86.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7773)
Chromosome
9
Position
47.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7772)
Chromosome
9
Position
92.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG421 was used as an overgo probe on plate 14 [well H7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTTGTTCGCGGTAGTTGATGTTG
B sequence
CAAGCAGATGAATCAGCAACATCA
AB sequence
CTTTGTTCGCGGTAGTTGATGTTGCTGATT
Marker sequence
TATATAATCGATCTGTTCTATGAACTTCAAATTACTTATTTTTTGTGATT
TTTTTGATATTTTTTTTGACTTTGGATGACTTAGATCTGTTGTTTAGTTC
ATTTTGACTTGAACTTTGAGTTGCTTATCGCTTTAGCCTTAGATCTAGTT
ATTAACTGTTAGTTTTATGATTTAGTGGCTGATCCTTGTTAATGAGATTT
GTAGAGTTCTGATTTCCTTATAAAATGTTGTTTTGAGTATTTAGATGAAT
AAAAAGTAGTTTAAGCTACAACTATTAAGAGAGTATTACTTTGTTCGCGG
TAGTTGATGTTGCTGATTCATCTGCTTGATGTATTTGTTGTTATTTTACC
ATTTAGTATTAACTGTATTAGCTTGCAAGGTTGAGATTTGGATCTTTGTT
GCTCCGATTTGTAACTTGAAACAATTAAAATGATGACCGTGTTCTTTTCT
GTTGTTGTTTGCTTTGATTTATATTTCTAATTTGATTTATTGATTGGAAA
GAGAAGATGAACTAATTTAAGATTGAGATTTAGTTGTTATTAGCATGATT
GAATTGATG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG421  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21 marker 21
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)